Advertisement

Genomic, serologic, and clinical case-control study of Chlamydia pneumoniae and peripheral artery occlusive disease

      Abstract

      Objectives

      Chlamydia pneumoniae has been related to atherosclerotic disease in both seroepidemiologic and genomic studies. We performed a case-control study to determine seropositivity and DNA detection in arteries of patients with peripheral artery occlusive disease and of healthy subjects.

      Methods

      The study included 64 patients with peripheral artery occlusive disease, and 50 control subjects who underwent varicose vein surgery, matched to the patient group for age, sex, and tobacco use. The fibrinogen level in all study subjects was measured as a marker of inflammation. Blood samples were taken from all subjects for determination of immunoglobulin (Ig) G elementary bodies (EB) against C pneumoniae with microimmunofluorescence (MIF) and enzyme-linked immunosorbent assay (ELISA), and of IgA EB with ELISA. The cutoff titers were 1:32 for MIF and 1.1 for ELISA. Biopsy specimens of arterial atheromatous plaque were obtained from patients, and of pudendal artery and saphenous vein from control subjects, and were studied with hemi-nested polymerase chain reaction.

      Results

      There were no differences in fibrinogen level between patients and controls. The prevalence of IgG anti-EB with MIF was 78% in patients and 24% in control subjects (P =.0001; odds ratio [OR], 11.3; 95% confidence interval [CI], 4.7-27.2). Prevalence of IgG anti-EB with ELISA was 75% in patients and 16% in control subjects (P = .0001; OR, 15.7; 95% CI, 6.1-40). There were no differences in IgA anti-EB titers. Bacterial DNA was detected in 67% of atheromatous plaques versus 12% of pudendal arteries (P = .0001) and 4% of saphenous veins. A weak correlation was found between seropositivity and the presence of intravascular DNA.

      Conclusions

      Our results support the hypothesis that C pneumoniae is related to the pathogenesis of atherosclerotic peripheral artery occlusive disease.

      Abstract

      Clinical relevance

      This study explored the infectious hypothesis in the context of the pathogenesis of atherosclerosis. This hypothesis has been supported by findings that certain infectious agents can cause or accelerate the course of diseases in which the possibility of a microbial cause was not previously proposed, as in the case of peptic ulcer and spongiform encephalopathy. The present study demonstrated the presence of Chlamydia pneumoniae and seropositivity in atheromatous plaques in patients with peripheral artery occlusive disease. These results contribute to a body of research that is opening up the possibility of treating atherosclerotic disease with antibiotic agents, and preventing it with immunization.
      The infectious pathogenesis of atherosclerosis was originally proposed by Osler in 1908, but was rapidly discarded after failure to isolate any pathogen responsible.
      • Osler W.
      Diseases of the arteries.
      Atherosclerosis was subsequently associated with herpes simplex virus and cytomegalovirus.
      • Fabricant C.G.
      Atherosclerosis the consequence of infection with a herpes virus.
      ,
      • Smieja M.
      • Gnarpe J.
      • Lonn E.
      • Gnarpe H.
      • Olsson G.
      • Yi Q.
      • et al.
      Heart Outcomes Prevention Evaluation (HOPE) study investigators. Multiple infections and subsequent cardiovascular events in the Heart Outcomes Prevention Evaluation (HOPE) study.
      Not until 1988 did Saikku et al
      • Saikku P.
      • Leinonen M.
      • Mattila K.
      • Ekman M.R.
      • Nieminen M.S.
      • Makela P.H.
      • et al.
      Serologic evidence of an association of a novel Chlamydia TWAR, with chronic coronary heart disease and acute myocardial infarction.
      publish the first seroepidemiologic study that reported high titers of circulating antibodies against Chlamydia pneumoniae
      • Everett K.
      • Bush R.
      • Andersen A.
      Emended description of the order Chlamydiales, proposal of Parachlamydiaceae fam. nov. and Simkaniaceae fam. nov., each containing one monotypic genus, revised taxonomy of the family Chlamydiaceae, including a new genus and five new species, and standards for the identification of organisms.
      in patients with coronary atherosclerosis. These findings were corroborated by Thom et al,
      • Thom D.
      • Wang S.
      • Grayston J.
      • Siscovick D.S.
      • Stewart D.K.
      • Kronmal R.A.
      • et al.
      Chlamydia pneumoniae strain TWAR antibody and angiographically demonstrated coronary artery disease.
      who discovered the bacteria in 1991, and Saikku et al
      • Saikku P.
      • Leinonen M.
      • Tenkanen L.
      • Linnanmaki E.
      • Ekman M.R.
      • Manninen V.
      • et al.
      Chronic Chlamydia pneumoniae infection as a risk factor for coronary heart disease in the Helsinki Heart Study.
      repeated their own results in a wider study in 1992. Later studies also demonstrated the presence of circulating immunocomplexes against C pneumoniae in patients with ischemic heart disease.
      • Leinonen M.
      • Linnanmaki E.
      • Mattila K.
      • Nieminen M.S.
      • Valtonen V.
      • Leirisalo-Repo M.
      • et al.
      Circulating immune complexes containing chlamydial lipopolysaccharide in acute myocardial infarction.
      In 1992 C pneumoniae in atherosclerotic vascular tissue was first reported,
      • Shor A.
      • Kuo C.C.
      • Patton D.L.
      Detection of Chlamydia pneumoniae in coronary arterial fatty streaks and atheromatous plaques.
      detected with immunocytochemistry. This microorganism has also been detected with electronic microscopy and polymerase chain reaction (PCR) studies, and at culture of biopsy specimens of the atherosclerotic aortic, coronary, femoral, and carotid artery walls.
      • Wong Y.K.
      • Gallagher P.J.
      • Ward M.E.
      Chlamydia pneumoniae and atherosclerosis.
      Several subsequent studies have suggested that chronic infection with C pneumoniae may contribute to the pathogenesis of atherosclerosis.
      • Gupta S.
      • Leatham E.
      The relation between C. pneumoniae and atherosclerosis.
      ,
      • Neumann F.
      Chlamydia pneumoniae–atherosclerosis link a sound concept in search for clinical relevance.
      The objective of the present case-control study was to assess the relationship between C pneumoniae and peripheral artery occlusive disease (PAOD) involving the carotid, femoral, and aortoiliac arteries. The study comprised 3 parts: clinical study (inflammation markers), study of immune response, and detection of C pneumoniae DNA in samples of arterial wall from patients and control subjects.

      Methods

      An observational, analytical case-control study was conducted in 114 patients treated in the Vascular Surgery Department at our center. All laboratory determinations, including antibodies, lipids, fibrinogen, and determination of C pneumoniae DNA, were processed and interpreted in blinded fashion.

       Patients

      One hundred twenty-six consecutive patients who required revascularization surgery to treat PAOD at various sites were recruited for the study. Thirty-nine patients with active inflammatory or infectious processes were excluded, as were 23 patients with Fontaine grade IV lower limb ischemia. Therefore there were 64 patients, all with Fontaine grade II or III disease. Further information on anatomic subgroups and clinical characteristics of these patients is given in Table I. The control group comprised 50 subjects with chronic superficial venous insufficiency.
      Table IAnatomic-clinical subgroups of patients with peripheral artery occlusive disease, and criteria for inclusion in study
      Clinical subgroupsCase subjectsClinical status
      Cerebrovascular disease2621, stroke plus ICA stenosis
      >70%
      5, ICA stenosis >99%
      Aortoiliac disease1810, G-II (Fontaine)
      8, G-III (Fontaine)
      Femoropopliteal disease205, G-II (Fontaine)
      15, G-III (Fontaine)
      ICA, Internal carotid artery.
      It should be borne in mind that the control subjects were recruited from among patients who underwent surgery to treat chronic venous insufficiency, consisting of saphenectomy under regional or general anesthesia, and all had C2 or C3 disease, according to the CEAP classification system. Consequently all control subjects underwent general examination in the Anesthesia Department, including electrocardiography, chest x-ray studies, blood and biochemical analyses, and circulatory examination. In all control subjects anesthetic risk was American Society of Anesthesiologists (ASA) I or II. Control subjects with coronary, pulmonary, or renal disease, either previously known or discovered during the preoperative examination, were excluded from the study. The absence of posterior tibial pulse or dorsal pedal pulse was an exclusion criterion, but no patients were excluded for this reason. All control subjects underwent carotid duplex ultrasound scanning, and none demonstrated stenosis greater than 20%.
      Patients and control subjects enrolled in the study were interviewed regarding previous genitourinary infections, to avert possible serologic cross-reactions between C pneumoniae and Chlamydia trachomatis. No history of these infections was reported by any subject. For the same reason, patients with chronic respiratory disease or pneumonia in the previous 3 months were excluded, to avert cross-reactions with Chlamydia psittaci. We also excluded patients with any chronic inflammatory or infectious diseases other than atherosclerosis. To prevent the possible elimination of C pneumoniae with use of antibiotic agents, patients who received antibiotic therapy for any reason in the previous 3 months were excluded, as were subjects allergic to β-lactam, because our antibiotic prophylaxis for these patients is with erythromycin, an effective antibiotic against C pneumoniae.
      All subjects selected for the study signed informed consent forms to participate. The study was approved by the ethics committee at our center.

       Clinical determinations

      Clinical and analytical data considered included sex, exposure to tobacco, obesity (>30% above theoretical weight), systolic arterial blood pressure, hypertension, cholesterol concentration, hypercholesterolemia, triglyceride concentration, and hypertriglyceridemia. Current smokers and ex-smokers who had smoked for more than 10 years were considered exposed to tobacco.

       Marker of inflammation

      Fibrinogen levels were always determined (P-T Fibrinogen HS) before surgery, with the derived fibrinogen assay.

       Antibody determinations

      Immunoglobulin (Ig) G to elementary body (EB) of C pneumoniae was studied with two analytic techniques: indirect microimmunofluorescence (MIF; MRL Chlamydia pneumoniae IgG MIF), performed as described,
      • Bennedsen M.
      • Berthelsen L.
      • Lind I.
      Performance of three microimmunofluorescence assays for detection of Chlamydia pneumoniae immunoglobulin M, G and A antibodies.
      ,
      • Caldwell H.A.
      • Kromhout J.
      • Schachter J.
      Purification and partial characterization of the major outer membrane protein of Chlamydia trachomatis.
      and enzyme-linked immunosorbent assay (ELISA; Chlamydia pneumoniae IgG Vircell), as described.
      • Gutierrez J.
      • Mendoza J.
      • Fernandez F.
      • Linares-Palomino J.
      • Soto M.J.
      • Maroto M.C.
      ELISA test to detect Chlamydophila pneumoniae IgG.
      For greater precision, the process was automated with the use of a sample dilutor (TECAN Megaflex) and plate processor for ELISA (BEP III; Dade Behring). A single experienced researcher made the MIF observations, which were carried out in duplicate to confirm their validity. Before evaluation of the results, 10% of the samples were retested, and similar results were obtained.
      For the MIF technique we considered all titers 1:32 or greater as positive. IgA to EB was also studied with ELISA (C pneumoniae IgA Vircell), with use of Chlamydia outer membrane complexes. Absorbance was measured at 450 or 620 nm. Results were expressed as indexes by dividing the absorbance of the sample by that of the cutoff. Indexes less than 0.9 were scored as negative, 0.9 to 1.1 as uncertain, and greater than 1.1 as positive. Studies with uncertain results were repeated, and the new result was taken as valid. For greater precision the process was automated with the use of a sample dilutor (TECAN Megaflex) and plate processor (BEP III; Dade Behring). Before evaluation of the results, 10% of the samples were retested, and similar results were obtained.

       Determination of C pneumoniae DNA in biopsy specimens

      In the patient group, histologic samples were obtained from the atheromatous plaques collected during carotid thromboendarterectomy, femoropopliteal bypass, or aortoiliac bypass surgery. In the control subjects a 1-cm segment of the pudendal artery was collected during the varicose vein surgery. The presence of C pneumoniae DNA was compared between samples from patients and control subjects. A segment of varicose saphenous vein from the control subjects was also obtained and processed. The biopsy specimens were immediately washed with physiologic saline solution to remove any remaining blood or perivascular tissue, and were immersed in sterile sucrose-phosphate-glutamic acid buffer transport and preservation medium. They were refrigerated at −4°C to −10°C for 12 to 16 hours, and then maintained at −70°C until analysis with hemi-nested PCR.
      A personal modification
      • Gutierrez J.
      • Linares-Palomino J.
      • Lopez-Espada C.
      • Rodriguez M.
      • Ros E.
      • Piedrola G.
      • et al.
      Chlamydia pneumoniae DNA in the arterial wall of patients with peripheral vascular disease.
      of the technique initially described by Campbell et al
      • Campbell L.A.
      • Perez-Melgosa M.
      • Hamilton D.
      • Kuo C.C.
      • Grayston J.T.
      Detection of C. pneumoniae by polymerase chain reaction.
      was used. The samples were homogenized, and DNA was extracted for enzymatic digestion with proteinase K. The amount of DNA was matched among samples (50-100 ng/mL). The first PCR was carried out with the primers HL-1 (GTTGTTCATGAAGGCCTACT) and HR-1 (TGCATAACCTACGGTGTGTT) with a Perkin-Elmer 9600 thermocycler, and produced a fragment of 437 base pairs. A second PCR was performed on this product, with primers HR-1 and HM-1 (GTGTCATTCGCCAAGGTTAA), and produced a shorter fragment of only 229 base pairs. All primers were of the Pst-1 segment. The reading was performed with electrophoresis in 2% agarose gel. The β-actin gene served as internal control for DNA amplification and extraction.
      To prevent false positive amplifications, procedures recommended to prevent contamination were strictly observed and all reactions were performed under stringent conditions. All reagents were aliquoted and stored in different locations. PCR reagents were prepared before each assay in a master mixture, which was then aliquoted. Preparation of the master mixture, extraction of the DNA and addition of the template to the PCR mixture, and thermal cycling were performed in 3 different, well-separated rooms, each with its own dedicated set of micropipettes and gowns. Only aerosol-resistant barrier pipette tips were used. Meticulous laboratory techniques and adherence to standard PCR anti-contamination procedures were the norm, including frequent glove changes and decontamination of surfaces with ultraviolet (UV) light and sodium hypochlorite. All tubes, pipette tips, and reagents, except for the primers and Taq polymerase, were exposed to 254 nm of UV light in a nucleic acid linker oven (Stratalinker UV Crosslinker; Stratagene) before use. A number of negative controls (numerous negative water and PCR reagent-only samples) were included in each PCR assay.

       Statistical analysis

      Statistical analysis was carried out with the SPSS statistical package (version 10, 2001; SPSS Inc). Exact logistic regression was performed with the LogXact program (version 2.1, 1996; Civel Software Corp). Continuous variables were compared with the Student t test. Discrete variables were analyzed with the χ2 test or Fischer exact test; the Pearson correlation was used to calculate the correlation among the variables. Exact logistic regression was used to fit a multivariate model explaining the presence of C pneumoniae, and the Hosmer-Lemeshow test was applied to the adjusted model.

      Results

      Adequate samples for analysis were obtained from all 114 study patients, with no accidental losses or destruction. Patient baseline characteristics are shown in Table II. There were no significant differences in the distribution of sex, tobacco exposure, or age above the 25th percentile between the two groups. The mean age of the patients was 6 years older than that of the control subjects.
      Table IIBaseline clinical characteristics of 64 subjects with PAOD (cases) compared with 50 subjects without PAOD (controls)
      Cases (N = 64)Controls (N = 50)P
      Age (y) (mean ± SD)66.06 ± 7.460.12 ± 3.49<.0001
      Student t test.
      Age >59 y (first quartile) (%)84.476.261
      χ2 test.
      Male sex (%)79.780.967
      χ2 test.
      Smoking (past or current) (%)71.960.182
      χ2 test.
      Diabetes mellitus (%)31.34<.0001
      Fischer exact test.
      Hypertension (%)53.18<.0001
      χ2 test.
      Hypercholesterolemia (%)29.74<.0001
      Fischer exact test.
      Hypertriglyceridemia (%)28.18.007
      χ2 test.
      Obesity (%)26.628.2.864
      χ2 test.
      PAOD, Peripheral artery occlusive disease.
      Student t test.
      χ2 test.
      Fischer exact test.

       Comparability

      There were differences between the groups in other covariables studied. Diabetes, hypertension, hypercholesterolemia, and hypertriglyceridemia occurred much more frequently in patients compared with control subjects. There was no significant difference in obesity between the groups.
      To fit a multivariate model explaining the presence or absence of C pneumoniae between study groups, and taking into account the sample size, exact logistic regression was applied (Table III, online only). The only factor identified as clearly and strongly significant was the effect of belonging to the patient or control group (odds ratio [OR], 18.055; 95% confidence interval [CI], 4.260-76.527). The high value of the OR estimated in this case may be explained by overestimation due to the sample size and strong relationship between risk factors. The goodness of fit of the adjusted model was verified with the Hosmer-Lemeshow test, and was not significant (χ2 = 12.742; P = .121; 8 degrees of freedom). In addition, outliers and weighted data were looked for; none were detected.

       Marker of inflammation

      Fibrinogen levels were 367.69 ± 96.81 in patients versus 355 ± 79.11 in control subjects. This small difference was not statistically significant (P = .454, Student t test). The value of the third quartile was 422.25 mg/dL; 26.6% of patients had levels above this value, versus 22% of control subjects. This difference was not statistically significant (P =.574, χ2 test). The OR for fibrinogen above the 75th percentile was 1.282 (95% CI, 0.538-3.058).

       Anti–C pneumoniae antibodies

      These results are shown in two ways: not grouped, either for MIF or ELISA (Table IV; Fig 1), and analyzed as positive or negative (Table V, Table VI). With MIF and ELISA, titers for IgG were 75% and 78%, respectively, in patients, versus 16% and 24%, respectively, in control subjects. This difference was statistically significant with both methods (P < .0001, χ2 test), with an OR of 11.31 (95% CI, 4.696-27.236) for MIF and 15.75 (95% CI, 6.126-40.495) for ELISA.
      Table IVDistribution of IgG-EB titers with MIF technique
      <1/161/161/321/641/128
      n%n%n%n%n%
      Cases46.251015.61117.22132.81828.1
      Controls30608168164800
      P <.0001
      χ2 test.
      IgG, Immunoglobulin G; EB, elementary body; MIF, microimmunofluoroescence.
      χ2 test.
      Figure thumbnail GR1
      Fig 1Distribution of IgG and IgG antibody titers with enzyme-linked immunosorbent assay Technique (cutoff point, 1.1). IgG-EB, Immunoglobulin G elementary bodies; IgA-EB, immunoglobulin A elementary bodies.
      Table VAntibodies against elementary body of Chlamydia pneumoniae
      AntibodyTechniqueSeropositivity (%)Odds ratio95% Confidence interval
      CasesControls
      IgG-EBMIF78.12411.314.696–27.236
      IgG-EBELISA751615.756.126–40.495
      IgA-EBELISA7.8160.4450.136–1.456
      Ig, Immunoglobulin; EB, elementary body; MIF, microimmunofluorescence; ELISA, enzyme-linked immunosorbent assay.
      Table VISeropositivity of different antibodies against elementary bodies of Chlamydia pneumoniae and DNA detection in anatomic-clinical subgroups studied
      Aortic (%)Femoral (%)Carotid (%)P
      χ2 test.
      MIFIgG-EB77.89069.2.240
      ELISAIgG-EB61.18576.9.227
      ELISAIgA-EB11.1015.0.142
      DNAPositive66.76569.2.954
      MIF, Microimmunofluorescence; ELISA, enzyme-linked immunosorbent assay; Ig, immunoglobulin; EB, elementary body.
      χ2 test.
      IgA seropositivity was 7.8% in patients, versus 16% in control subjects. This difference was not statistically significant (P = .172, χ2 test), with an OR of 0.445 (95% CI, 0.136-1.458).
      Results for clinical subgroups considered, showing a uniform distribution, are shown in Table VI.

       C pneumoniae DNA

      C pneumoniae DNA was detected with PCR in 43 atheromatous plaques from patients (67.2%) and 6 external pudendal arteries from control subjects (12%; Fig 2, Fig 3), a statistically significant difference (P < .0001, χ2 test). Table VI shows that the presence of C pneumoniae DNA had a uniform distribution among subgroups.
      Figure thumbnail GR2
      Fig 2Detection of Chlamydia pneumoniae DNA in samples of vascular tissue detected with polymerase chain reaction in 43 of 64 atheromatous plaques from patients, 6 of 50 external pudendal arteries from control subjects, and 2 of 50 saphenous veins.
      Figure thumbnail GR3
      Fig 3Amplification of Chlamydia pneumoniae DNA (agarose gel). Lane 1, MW 154-2176 bp; lane 2, negative control; lane 3, positive sample; lane 4, negative sample; lane 5, MW 8-578 bp. bp, Base pairs.
      Detection of C pneumoniae DNA in saphenous vein samples was considered separately. It was detected in 2 samples (4%) from 2 control subjects with positive DNA in the external pudendal artery.

       Correlation between antibodies and intraplaque infection

      The relationship among the diagnostic capabilities of the 3 serologic determinations was studied. Comparison between the 2 IgG antibody techniques showed that both were positive in 47 patients and both were negative in 43 patients (r = 0.582, Pearson correlation; P = .001, χ2). The results for intraplaque infection are exhibited in Table VII. Although the correlation rates for IgG were low, they were statistically significant. IgA antibodies were not correlated with IgG or genomic detection.
      Table VIICorrelation between seropositivity according to different serologic techniques and intraplaque infection determined by presence of DNA of Chlamydia pneumoniae
      Positive antibodiesPositive DNACorrelationOdds ratio95% Confidence interval
      r
      Pearson coefficient.
      P
      χ2 test.
      IgG-EB (MIF)370.368.00014.032.17–11.21
      IgG-EB (ELISA)360.423.00016.232.73–14.21
      IgA-EB (ELISA)3−0.144.1120.360.09–1.38
      Ig, Immunoglobulin; EB, elementary body; MIF, microimmunofluorescence; ELISA, enzyme-linked immunosorbent assay.
      Pearson coefficient.
      χ2 test.

      Discussion

      The findings of the present case-control study support the hypothesis that C pneumoniae has a role in atherosclerosis, because the rates of seropositivity and DNA detection were higher in patients than in matched control subjects. The strengths of this study are that an adjusted case-control design was followed, and serologic, clinical, and genomic studies were performed.
      It was not easy to find sufficient adults older than 65 years who could supply an artery during a surgical intervention and form a comparable control group. The control subjects were selected after recruitment of the patients, to control for the 2 main risk factors, age and sex. Although patients with PAOD were significantly older, by 6 years,) than control subjects, the model was comparable (Table III). The control subjects were also matched for tobacco use, to avert a possible bias reported in the literature.
      • Hahn D.L.
      • Golubjatnikov R.
      Smoking is a potential confounder of the C. pneumoniae coronary artery disease association.
      The extraction of a segment of the external pudendal artery during conventional varicose vein surgery is a minimal procedure, because this artery can normally be ligated if required. The novelty of this work was the extraction of arteries for analysis. There were no postoperative complications attributable to extraction of biopsy specimens of external pudendal artery.
      Fibrinogen levels, as a marker of inflammation and chronic infection, were slightly higher in the PAOD group, although the difference did not reach statistical significance. Variable data have been reported by other authors.
      • Markus H.
      • Sitzer M.
      • Carrington D.
      • Mendall M.A.
      • Steinmetz H.
      Chlamydia pneumoniae infection and early asymptomatic carotid atherosclerosis.
      ,
      • Toss H.
      • Gnarpe J.
      • Gnarpe H.
      • Siegbahn A.
      • Lindahl B.
      • Wallentin L.
      Increased fibrinogen levels are associated with persistent Chlamydia pneumoniae infection in unstable coronary artery disease.
      Seropositivity for IgG-EB with MIF was defined at a high level of greater than 1:32 titers, because in a recent workshop on standardization of C pneumoniae diagnostic methods the Centers for Disease Control and Prevention regarded an IgG titer greater than 16 as indicating past exposure.
      • Dowell S.F.
      • Peeling R.W.
      • Boman J.
      • Carlone G.M.
      • Fields B.S.
      • Guarner J.
      • et al.
      Standardizing Chlamydia pneumoniae assays recommendations from the Centers for Disease Control and Prevention (USA) and the Laboratory Centre for Disease Control (Canada).
      We believe that we increased the specificity of the test by using a cutoff titer greater than 1:32. The ELISA technique, which obviates this problem, showed similar seropositivity values as the MIF results.
      The OR ratios are higher than in previous reports, with only a few studies
      • Mendall M.A.
      • Carrington D.
      • Strachan D.
      • Patel P.
      • Molineaux N.
      • Levi J.
      • et al.
      C. pneumoniaerisk factors for seropositivity and association with coronary heart disease.
      ,
      • Karunakaran K.
      • Blanchard J.
      • Raudonikiene A.
      • Shen C.
      • Murdin A.D.
      • Brunham R.C.
      Molecular detection and seroepidemiology of the Chlamydia pneumoniae bacteriophage (PhiCpn1).
      ,
      • Sessa R.
      • DiPietro M.
      • Schiavoni G.
      • Santino I.
      • Cipriani P.
      • Romano S.
      • et al.
      Prevalence of Chlamydia pneumoniae in peripheral blood mononuclear cells in Italian patients with acute ischaemic heart disease.
      showing ORs within this range; however, bear in mind that thresholds for seropositivity are highly variable. There have been no reports of ORs above 10 with ELISA, although this remains a little-used technique.
      • Gutierrez J.
      • Mendoza J.
      • Fernandez F.
      • Linares-Palomino J.
      • Soto M.J.
      • Maroto M.C.
      ELISA test to detect Chlamydophila pneumoniae IgG.
      ,
      • Mendall M.A.
      • Carrington D.
      • Strachan D.
      • Patel P.
      • Molineaux N.
      • Levi J.
      • et al.
      C. pneumoniaerisk factors for seropositivity and association with coronary heart disease.
      ,
      • Mazzoli S.
      • Tofani N.
      • Fantini A.
      • Semplici F.
      • Bandini F.
      • Salvi A.
      • et al.
      Chlamydia pneumoniae antibody response in patients with acute myocardial infarction and their follow-up.
      Our findings for IgA-EB are comparable with recent studies, which also found low rates of seropositivity.
      • Smieja M.
      • Gnarpe J.
      • Lonn E.
      • Gnarpe H.
      • Olsson G.
      • Yi Q.
      • et al.
      Heart Outcomes Prevention Evaluation (HOPE) study investigators. Multiple infections and subsequent cardiovascular events in the Heart Outcomes Prevention Evaluation (HOPE) study.
      ,
      • Sessa R.
      • DiPietro M.
      • Schiavoni G.
      • Santino I.
      • Cipriani P.
      • Romano S.
      • et al.
      Prevalence of Chlamydia pneumoniae in peripheral blood mononuclear cells in Italian patients with acute ischaemic heart disease.
      ,
      • Porqueddu M.
      • Spirito R.
      • Parolari A.
      • Zanobini M.
      • Pompilio G.
      • Polvani G.
      • et al.
      Lack of association between serum immunoreactivity and Chlamydia pneumoniae detection in the human aortic wall.
      Results of published seroepidemiologic case-control studies are conflicting, with some
      • Melnick S.L.
      • Shahar E.
      • Folsom A.R.
      • Grayston J.T.
      • Sorlie P.D.
      • Wang S.P.
      • et al.
      Past infection by Chlamydia pneumoniae strain TWAR and asymptomatic carotid atherosclerosis. Atherosclerosis Risk in Communities (ARIC) study investigators.
      ,
      • Blanchard J.
      • Armenian H.
      • Peeling R.
      • Friesen P.P.
      • Shen C.
      • Brunham R.C.
      The relation between Chlamydia pneumoniae infection and abdominal aortic aneurysm case-control study.
      ,
      • Elkind M.S.
      • Lin I.F.
      • Grayston J.T.
      • Sacco R.L.
      Chlamydia pneumoniae and the risk of first ischemic stroke the Northern Manhattan Stroke Study.
      reporting that seropositivity to C pneumoniae is associated with arterial disease and others
      • Porqueddu M.
      • Spirito R.
      • Parolari A.
      • Zanobini M.
      • Pompilio G.
      • Polvani G.
      • et al.
      Lack of association between serum immunoreactivity and Chlamydia pneumoniae detection in the human aortic wall.
      ,
      • Danesh J.
      • Whincup P.
      • Walker M.
      • Lennon L.
      • Thomson A.
      • Appleby P.
      • et al.
      Chlamydia pneumoniae IgG titres and coronary heart disease prospective study and meta-analysis.
      reporting that it is not. Even case-control studies published by the Atherosclerosis Risk in Communities study researchers came to divergent conclusions, with an OR of 2.00 for seropositivity in patients with stroke
      • Melnick S.L.
      • Shahar E.
      • Folsom A.R.
      • Grayston J.T.
      • Sorlie P.D.
      • Wang S.P.
      • et al.
      Past infection by Chlamydia pneumoniae strain TWAR and asymptomatic carotid atherosclerosis. Atherosclerosis Risk in Communities (ARIC) study investigators.
      but no association in patients with coronary heart disease.
      • Nieto F.
      • Folsom A.
      • Sorlie P.
      • Grayston J.T.
      • Wang S.P.
      • Chambless L.E.
      Chlamydia pneumoniae infection and incident coronary heart disease the Atherosclerosis Risk in Communities Study.
      An issue that is yet to be resolved is the type of antigen to be used in serologic testing. Traditionally lipopolysaccharide has been used, but tests are now available against EB and other epitopes, promising improved sensitivity and specificity. The genomic study found C pneumoniae DNA in 67.2% of samples of diseased arteries versus 12% of atheroma-free arteries. PCR is a highly specific technique, and provides a reliable diagnosis.
      • Campbell L.A.
      • Perez-Melgosa M.
      • Hamilton D.
      • Kuo C.C.
      • Grayston J.T.
      Detection of C. pneumoniae by polymerase chain reaction.
      We used a hemi-nested PCR, thereby achieving virtually total certainty that the DNA fragments found were of C pneumoniae.
      • Hahn D.L.
      • Golubjatnikov R.
      Smoking is a potential confounder of the C. pneumoniae coronary artery disease association.
      ,
      • Markus H.
      • Sitzer M.
      • Carrington D.
      • Mendall M.A.
      • Steinmetz H.
      Chlamydia pneumoniae infection and early asymptomatic carotid atherosclerosis.
      ,
      • Toss H.
      • Gnarpe J.
      • Gnarpe H.
      • Siegbahn A.
      • Lindahl B.
      • Wallentin L.
      Increased fibrinogen levels are associated with persistent Chlamydia pneumoniae infection in unstable coronary artery disease.
      ,
      • Mendall M.A.
      • Carrington D.
      • Strachan D.
      • Patel P.
      • Molineaux N.
      • Levi J.
      • et al.
      C. pneumoniaerisk factors for seropositivity and association with coronary heart disease.
      ,
      • Karunakaran K.
      • Blanchard J.
      • Raudonikiene A.
      • Shen C.
      • Murdin A.D.
      • Brunham R.C.
      Molecular detection and seroepidemiology of the Chlamydia pneumoniae bacteriophage (PhiCpn1).
      ,
      • Sessa R.
      • DiPietro M.
      • Schiavoni G.
      • Santino I.
      • Cipriani P.
      • Romano S.
      • et al.
      Prevalence of Chlamydia pneumoniae in peripheral blood mononuclear cells in Italian patients with acute ischaemic heart disease.
      ,
      • Mazzoli S.
      • Tofani N.
      • Fantini A.
      • Semplici F.
      • Bandini F.
      • Salvi A.
      • et al.
      Chlamydia pneumoniae antibody response in patients with acute myocardial infarction and their follow-up.
      ,
      • Porqueddu M.
      • Spirito R.
      • Parolari A.
      • Zanobini M.
      • Pompilio G.
      • Polvani G.
      • et al.
      Lack of association between serum immunoreactivity and Chlamydia pneumoniae detection in the human aortic wall.
      ,
      • Melnick S.L.
      • Shahar E.
      • Folsom A.R.
      • Grayston J.T.
      • Sorlie P.D.
      • Wang S.P.
      • et al.
      Past infection by Chlamydia pneumoniae strain TWAR and asymptomatic carotid atherosclerosis. Atherosclerosis Risk in Communities (ARIC) study investigators.
      ,
      • Blanchard J.
      • Armenian H.
      • Peeling R.
      • Friesen P.P.
      • Shen C.
      • Brunham R.C.
      The relation between Chlamydia pneumoniae infection and abdominal aortic aneurysm case-control study.
      ,
      • Elkind M.S.
      • Lin I.F.
      • Grayston J.T.
      • Sacco R.L.
      Chlamydia pneumoniae and the risk of first ischemic stroke the Northern Manhattan Stroke Study.
      ,
      • Danesh J.
      • Whincup P.
      • Walker M.
      • Lennon L.
      • Thomson A.
      • Appleby P.
      • et al.
      Chlamydia pneumoniae IgG titres and coronary heart disease prospective study and meta-analysis.
      ,
      • Nieto F.
      • Folsom A.
      • Sorlie P.
      • Grayston J.T.
      • Wang S.P.
      • Chambless L.E.
      Chlamydia pneumoniae infection and incident coronary heart disease the Atherosclerosis Risk in Communities Study.
      ,
      • Mahony J.
      • Chongs S.
      • Coombes B.K.
      • Smieja M.
      • Petrich A.
      Analytical sensibility, reproducibility of results and clinical performance of five PCR assays for detecting Chlamydia pneumoniae DNA in peripheral blood mononuclear cells.
      However, the histologic structure of the pudendal artery is different from that of the femoral or carotid arteries, and it rarely is associated with atherosclerosis. We believe that the artery of a live person always offers better evidence than that of a cadaveric artery, used in other studies.
      • Petersen E.
      • Boman J.
      • Persson K.
      • Arnerlov C.
      • Wadell G.
      • Juto P.
      • et al.
      Chlamydia pneumoniae in human abdominal aortic aneurysms.
      ,
      • Maass M.
      • Krause E.
      • Engel P.
      • Kruger S.
      Endovascular presence of Chlamydia pneumoniae in patients with hemodynamically effective carotid artery stenosis.
      ,
      • Karlsson L.
      • Gnarpe J.
      • Naas J.
      • Olsson G.
      • Lindholm J.
      • Steen B.
      • et al.
      Detection of viable Chlamydia pneumoniae in abdominal aortic aneurysms.
      The main advantage of our approach is that a real case-control study can be performed with arterial tissue from comparable subjects.
      Twenty-two case-control studies that examined the presence of C pneumoniae in non-coronary atheromatous plaques with PCR have been published. In 8 studies the controls were apparently healthy arteries from patients; the DNA was detected in 0% to 76% of patients and 0% to 53% of control samples
      • Petersen E.
      • Boman J.
      • Persson K.
      • Arnerlov C.
      • Wadell G.
      • Juto P.
      • et al.
      Chlamydia pneumoniae in human abdominal aortic aneurysms.
      ,
      • Ong G.
      • Thomas B.J.
      • Mansfield A.O.
      • Davidson B.R.
      • Taylor-Robinson D.
      Detection and widespread distribution of Chlamydia pneumoniae in the vascular system and its possible implications.
      (Table VIII, online only).
      • Petersen E.
      • Boman J.
      • Persson K.
      • Arnerlov C.
      • Wadell G.
      • Juto P.
      • et al.
      Chlamydia pneumoniae in human abdominal aortic aneurysms.
      ,
      • Karlsson L.
      • Gnarpe J.
      • Naas J.
      • Olsson G.
      • Lindholm J.
      • Steen B.
      • et al.
      Detection of viable Chlamydia pneumoniae in abdominal aortic aneurysms.
      ,
      • Ong G.
      • Thomas B.J.
      • Mansfield A.O.
      • Davidson B.R.
      • Taylor-Robinson D.
      Detection and widespread distribution of Chlamydia pneumoniae in the vascular system and its possible implications.
      ,
      • Kuo C.C.
      • Shor A.
      • Campbell L.A.
      • Fukushi H.
      • Patton D.L.
      • Grayston J.T.
      Demonstration of Chlamydia pneumoniae in atherosclerotic lesions of coronary arteries.
      ,
      • Grayston J.T.
      • Kuo C.C.
      • Coulson A.S.
      • Campbell L.A.
      • Lawrence R.D.
      • Lee M.J.
      • et al.
      Chlamydia pneumoniae (TWAR) in atherosclerosis of the carotid artery.
      ,
      • Chiu B.
      • Viira E.
      • Tucker W.
      • Fong I.W.
      Chlamydia pneumoniae, cytomegalovirus, and herpes simplex virus in Atherosclerosis of the carotid artery.
      ,
      • Juvonen J.
      • Juvonen T.
      • Laurila A.
      • Alakarppa H.
      • Lounatmaa K.
      • Surcel H.M.
      • et al.
      Demonstration of Chlamydia pneumoniae in the walls of abdominal aortic aneurysms.
      ,
      • Maass M.
      • Bartels C.
      • Engel P.M.
      • Mamat U.
      • Sievers H.H.
      Endovascular presence of viable Chlamydia pneumoniae is a common phenomenon in coronary artery disease.
      ,
      • Farsak B.
      • Yildirir A.
      • Akyon Y.
      • Pinar A.
      • Oc M.
      • Boke E.
      • et al.
      Detection of Chlamydia pneumoniae and Helicobacter pylori DNA in human atherosclerotic plaques by PCR.
      ,
      • Song Y.G.
      • Kwon H.M.
      • Kim J.M.
      • Hong B.K.
      • Kim D.S.
      • Huh A.J.
      • et al.
      Serologic and histopathologic study of Chlamydia pneumoniae infection in atherosclerosis a possible pathogenetic mechanism of atherosclerosis induced by Chlamydia pneumoniae.
      ,
      • Berger M.
      • Schroder B.
      • Daeschlein G.
      • Schneider W.
      • Busjahn A.
      • Buchwalow I.
      • et al.
      Chlamydia pneumoniae DNA in non-coronary atherosclerotic plaques and circulating leukocytes.
      ,
      • Ouchi K.
      • Fujii B.
      • Kudo S.
      • Shirai M.
      • Yamashita K.
      • Gondo T.
      • et al.
      Chlamydia pneumoniae in atherosclerotic and nonatherosclerotic tissue.
      ,
      • LaBiche R.
      • Koziol D.
      • Quinn T.C.
      • Gaydos C.
      • Azhar S.
      • Ketron G.
      • et al.
      Presence of Chlamydia pneumoniae in human symptomatic and asymptomatic carotid atherosclerotic plaque.
      ,
      • Virok D.
      • Kis Z.
      • Karai L.
      • Intzedy L.
      • Burian K.
      • Szabo A.
      • et al.
      Chlamydia pneumoniae in atherosclerotic middle cerebral artery.
      ,
      • Ong G.M.
      • Coyle P.V.
      • Barros D'Sa A.A.
      • McCluggage W.G.
      • Duprex W.P.
      • O'Neill H.J.
      • et al.
      Non-detection of Chlamydia species in carotid atheroma using generic primers by nested PCR in a population with a high prevalence of Chlamydia pneumoniae antibody.
      ,
      • Rassu M.
      • Cazzavillan S.
      • Scagnelli M.
      • Peron A.
      • Bevilacqua P.A.
      • Facco M.
      • et al.
      Demonstration of Chlamydia pneumoniae in atherosclerotic arteries from various vascular regions.
      ,
      • Taylor-Robinson D.
      • Thomas B.J.
      • Goldin R.
      • Stanbridge R.
      Chlamydia pneumoniae in infrequently examined blood vessels.
      ,
      • Freidank H.M.
      • Lux A.
      • Dern P.
      • Meyer-Konig U.
      • Els T.
      Chlamydia pneumoniae DNA in peripheral venous blood samples from patients with carotid artery stenosis.
      ,
      • Shi Y.
      • Tokunaga O.
      Enigmatic relationship between Chlamydia pneumoniae and atherosclerosis.
      ,
      • Neureiter D.
      • Heuschmann P.
      • Stintzing S.
      • Kolominsky-Rabas P.
      • Barbera L.
      • Jung A.
      • et al.
      Detection of Chlamydia pneumoniae but not of Helicobacter pylori in symptomatic atherosclerotic carotids associated with enhanced serum antibodies, inflammation and apoptosis rate.
      ,
      • Lin T.M.
      • Chen W.J.
      • Chen H.Y.
      • Wang P.W.
      • Eng H.L.
      Increased incidence of cytomegalovirus but not Chlamydia pneumoniae in atherosclerotic lesions of arteries of lower extremities from patients with diabetes mellitus undergoing amputation.
      ,
      • Sessa R.
      • Di Pietro M.
      • Schiavoni G.
      • Santino I.
      • Benedetti-Valentini F.
      • Perna R.
      • et al.
      Chlamydia pneumoniae DNA in patients with symptomatic carotid atherosclerotic disease.
      We detected the DNA in 67% of patients versus 12% of control subjects. We have no explanation for our finding of C pneumoniae DNA in 6 control arteries, especially when 4 of them demonstrated negative serologic findings. This situation has been reported by other authors.
      • Nieto F.
      • Folsom A.
      • Sorlie P.
      • Grayston J.T.
      • Wang S.P.
      • Chambless L.E.
      Chlamydia pneumoniae infection and incident coronary heart disease the Atherosclerosis Risk in Communities Study.
      ,
      • Ong G.
      • Thomas B.J.
      • Mansfield A.O.
      • Davidson B.R.
      • Taylor-Robinson D.
      Detection and widespread distribution of Chlamydia pneumoniae in the vascular system and its possible implications.
      ,
      • Maass M.
      • Gieffers J.
      • Krause E.
      • Engel P.M.
      • Bartels C.
      • Solbach W.
      Poor correlation between microimmunofluorescence serology and polymerase chain reaction for detection of vascular Chlamydia pneumoniae infection in coronary artery disease patients.
      We are also unable to explain the presence of C pneumoniae DNA in 2 of 50 samples of varicose saphenous vein. Varicose vein walls can have a certain degree of inflammation,
      • Ciufetti G.
      • Mannarino E.
      • Praticcia R.
      Leukocyte activity in chronic venous insufficiency.
      and we could not determine whether the DNA came from vascular wall cells or from macrophages.
      Our study shows poor correlation between seropositivity and C pneumoniae DNA detection, and only for IgG-EB. Few studies have found any relationship, and always with a larger sample size than ours.
      • Sessa R.
      • DiPietro M.
      • Schiavoni G.
      • Santino I.
      • Cipriani P.
      • Romano S.
      • et al.
      Prevalence of Chlamydia pneumoniae in peripheral blood mononuclear cells in Italian patients with acute ischaemic heart disease.
      ,
      • Maass M.
      • Gieffers J.
      • Krause E.
      • Engel P.M.
      • Bartels C.
      • Solbach W.
      Poor correlation between microimmunofluorescence serology and polymerase chain reaction for detection of vascular Chlamydia pneumoniae infection in coronary artery disease patients.
      For infection to be a risk factor,
      • Wong Y.K.
      • Gallagher P.J.
      • Ward M.E.
      Chlamydia pneumoniae and atherosclerosis.
      ,
      • Gupta S.
      • Leatham E.
      The relation between C. pneumoniae and atherosclerosis.
      independent of other risk factors such as hyperlipidemia, tobacco use, hypertension, diabetes, or family history of the disease, it is necessary to address the action mechanism by which C pneumoniae produces atherosclerosis and to determine whether C pneumoniae causes the initial damage, triggering the atherosclerosis, or accelerates and aggravates previous atheromatous lesions. Even atherosclerotic plaques, with their high leukocyte content, may be a site where C pneumoniae is merely present without participating in the pathogenesis of atherosclerosis.
      It is not possible to deduce from our study the causal relationship between chronic C pneumoniae infection and PAOD. However, the high seropositivity rate in the patients and the frequent detection of viable C pneumoniae in the atheromatous plaques suggest that C pneumoniae infection has some role in the pathogenesis of atherosclerosis. Our finding of DNA in healthy arteries and varicose veins in patients without clinical PAOD can be variously interpreted as evidence for and against the participation of C pneumoniae in atherosclerosis.
      In conclusion, the findings of our matched case-control study further support the relationship between C pneumoniae infection and PAOD. Wider case-control studies of comparable subjects are warranted to definitively establish whether some chronic infections can induce atherosclerosis.

      References

        • Osler W.
        Diseases of the arteries.
        in: Osler W. Modern medicine: its practice and theory. Lea & Febiger, Philadelphia (PA)1908: 429-447
        • Fabricant C.G.
        Atherosclerosis.
        Adv Vet Sci Comp Med. 1985; 30: 39-66
        • Smieja M.
        • Gnarpe J.
        • Lonn E.
        • Gnarpe H.
        • Olsson G.
        • Yi Q.
        • et al.
        Heart Outcomes Prevention Evaluation (HOPE) study investigators. Multiple infections and subsequent cardiovascular events in the Heart Outcomes Prevention Evaluation (HOPE) study.
        Circulation. 2003; 107: 251-257
        • Saikku P.
        • Leinonen M.
        • Mattila K.
        • Ekman M.R.
        • Nieminen M.S.
        • Makela P.H.
        • et al.
        Serologic evidence of an association of a novel Chlamydia TWAR, with chronic coronary heart disease and acute myocardial infarction.
        Lancet. 1988; 11: 983-986
        • Everett K.
        • Bush R.
        • Andersen A.
        Emended description of the order Chlamydiales, proposal of Parachlamydiaceae fam. nov. and Simkaniaceae fam. nov., each containing one monotypic genus, revised taxonomy of the family Chlamydiaceae, including a new genus and five new species, and standards for the identification of organisms.
        Int J Syst Bacteriol. 1999; 49: 415-440
        • Thom D.
        • Wang S.
        • Grayston J.
        • Siscovick D.S.
        • Stewart D.K.
        • Kronmal R.A.
        • et al.
        Chlamydia pneumoniae strain TWAR antibody and angiographically demonstrated coronary artery disease.
        Arterioscler Thromb. 1991; 11: 547-551
        • Saikku P.
        • Leinonen M.
        • Tenkanen L.
        • Linnanmaki E.
        • Ekman M.R.
        • Manninen V.
        • et al.
        Chronic Chlamydia pneumoniae infection as a risk factor for coronary heart disease in the Helsinki Heart Study.
        Ann Intern Med. 1992; 116: 273-278
        • Leinonen M.
        • Linnanmaki E.
        • Mattila K.
        • Nieminen M.S.
        • Valtonen V.
        • Leirisalo-Repo M.
        • et al.
        Circulating immune complexes containing chlamydial lipopolysaccharide in acute myocardial infarction.
        Microb Pathogen. 1990; 9: 67-73
        • Shor A.
        • Kuo C.C.
        • Patton D.L.
        Detection of Chlamydia pneumoniae in coronary arterial fatty streaks and atheromatous plaques.
        S Afr Med J. 1992; 82: 158-161
        • Wong Y.K.
        • Gallagher P.J.
        • Ward M.E.
        Chlamydia pneumoniae and atherosclerosis.
        Heart. 1999; 81: 232-238
        • Gupta S.
        • Leatham E.
        The relation between C. pneumoniae and atherosclerosis.
        Heart. 1997; 77: 7-8
        • Neumann F.
        Chlamydia pneumoniae–atherosclerosis link.
        Circulation. 2002; 106: 2414-2416
        • Bennedsen M.
        • Berthelsen L.
        • Lind I.
        Performance of three microimmunofluorescence assays for detection of Chlamydia pneumoniae immunoglobulin M, G and A antibodies.
        Clin Diagn Lab Immunol. 2002; 9: 833-839
        • Caldwell H.A.
        • Kromhout J.
        • Schachter J.
        Purification and partial characterization of the major outer membrane protein of Chlamydia trachomatis.
        Infect Immun. 1981; 31: 1161-1176
        • Gutierrez J.
        • Mendoza J.
        • Fernandez F.
        • Linares-Palomino J.
        • Soto M.J.
        • Maroto M.C.
        ELISA test to detect Chlamydophila pneumoniae IgG.
        J Basic Microbiol. 2002; 42: 13-18
        • Gutierrez J.
        • Linares-Palomino J.
        • Lopez-Espada C.
        • Rodriguez M.
        • Ros E.
        • Piedrola G.
        • et al.
        Chlamydia pneumoniae DNA in the arterial wall of patients with peripheral vascular disease.
        Infection. 2001; 29: 196-200
        • Campbell L.A.
        • Perez-Melgosa M.
        • Hamilton D.
        • Kuo C.C.
        • Grayston J.T.
        Detection of C. pneumoniae by polymerase chain reaction.
        J Clin Microbiol. 1992; 30: 434-439
        • Hahn D.L.
        • Golubjatnikov R.
        Smoking is a potential confounder of the C. pneumoniae coronary artery disease association.
        Arterioscle Thromb. 1992; 12: 945-947
        • Markus H.
        • Sitzer M.
        • Carrington D.
        • Mendall M.A.
        • Steinmetz H.
        Chlamydia pneumoniae infection and early asymptomatic carotid atherosclerosis.
        Circulation. 1999; 100: 832-837
        • Toss H.
        • Gnarpe J.
        • Gnarpe H.
        • Siegbahn A.
        • Lindahl B.
        • Wallentin L.
        Increased fibrinogen levels are associated with persistent Chlamydia pneumoniae infection in unstable coronary artery disease.
        Eur Heart J. 1998; 19: 570-577
        • Dowell S.F.
        • Peeling R.W.
        • Boman J.
        • Carlone G.M.
        • Fields B.S.
        • Guarner J.
        • et al.
        Standardizing Chlamydia pneumoniae assays.
        Clin Infect Dis. 2001; 33: 492-503
        • Mendall M.A.
        • Carrington D.
        • Strachan D.
        • Patel P.
        • Molineaux N.
        • Levi J.
        • et al.
        C. pneumoniae.
        J Infect. 1995; 30: 121-128
        • Karunakaran K.
        • Blanchard J.
        • Raudonikiene A.
        • Shen C.
        • Murdin A.D.
        • Brunham R.C.
        Molecular detection and seroepidemiology of the Chlamydia pneumoniae bacteriophage (PhiCpn1).
        J Clin Microbiol. 2002; 40: 4010-4014
        • Sessa R.
        • DiPietro M.
        • Schiavoni G.
        • Santino I.
        • Cipriani P.
        • Romano S.
        • et al.
        Prevalence of Chlamydia pneumoniae in peripheral blood mononuclear cells in Italian patients with acute ischaemic heart disease.
        Atherosclerosis. 2001; 159: 521-525
        • Mazzoli S.
        • Tofani N.
        • Fantini A.
        • Semplici F.
        • Bandini F.
        • Salvi A.
        • et al.
        Chlamydia pneumoniae antibody response in patients with acute myocardial infarction and their follow-up.
        Am Heart J. 1998; 135: 15-20
        • Porqueddu M.
        • Spirito R.
        • Parolari A.
        • Zanobini M.
        • Pompilio G.
        • Polvani G.
        • et al.
        Lack of association between serum immunoreactivity and Chlamydia pneumoniae detection in the human aortic wall.
        Circulation. 2002; 106: 2647-2648
        • Melnick S.L.
        • Shahar E.
        • Folsom A.R.
        • Grayston J.T.
        • Sorlie P.D.
        • Wang S.P.
        • et al.
        Past infection by Chlamydia pneumoniae strain TWAR and asymptomatic carotid atherosclerosis. Atherosclerosis Risk in Communities (ARIC) study investigators.
        Am J Med. 1993; 95: 499-504
        • Blanchard J.
        • Armenian H.
        • Peeling R.
        • Friesen P.P.
        • Shen C.
        • Brunham R.C.
        The relation between Chlamydia pneumoniae infection and abdominal aortic aneurysm.
        Clin Infect Dis. 2000; 30: 946-947
        • Elkind M.S.
        • Lin I.F.
        • Grayston J.T.
        • Sacco R.L.
        Chlamydia pneumoniae and the risk of first ischemic stroke.
        Stroke. 2000; 31: 1521-1525
        • Danesh J.
        • Whincup P.
        • Walker M.
        • Lennon L.
        • Thomson A.
        • Appleby P.
        • et al.
        Chlamydia pneumoniae IgG titres and coronary heart disease.
        BMJ. 2000; 321: 208-213
        • Nieto F.
        • Folsom A.
        • Sorlie P.
        • Grayston J.T.
        • Wang S.P.
        • Chambless L.E.
        Chlamydia pneumoniae infection and incident coronary heart disease.
        Am J Epidemiol. 1999; 150: 149-156
        • Mahony J.
        • Chongs S.
        • Coombes B.K.
        • Smieja M.
        • Petrich A.
        Analytical sensibility, reproducibility of results and clinical performance of five PCR assays for detecting Chlamydia pneumoniae DNA in peripheral blood mononuclear cells.
        J Clin Microbiol. 2000; 38: 2622-2627
        • Petersen E.
        • Boman J.
        • Persson K.
        • Arnerlov C.
        • Wadell G.
        • Juto P.
        • et al.
        Chlamydia pneumoniae in human abdominal aortic aneurysms.
        Eur J Vasc Endovasc Surg. 1998; 15: 138-142
        • Maass M.
        • Krause E.
        • Engel P.
        • Kruger S.
        Endovascular presence of Chlamydia pneumoniae in patients with hemodynamically effective carotid artery stenosis.
        Angiology. 1997; 48: 699-706
        • Karlsson L.
        • Gnarpe J.
        • Naas J.
        • Olsson G.
        • Lindholm J.
        • Steen B.
        • et al.
        Detection of viable Chlamydia pneumoniae in abdominal aortic aneurysms.
        Eur J Vasc Endovasc Surg. 2000; 19: 630-635
        • Ong G.
        • Thomas B.J.
        • Mansfield A.O.
        • Davidson B.R.
        • Taylor-Robinson D.
        Detection and widespread distribution of Chlamydia pneumoniae in the vascular system and its possible implications.
        J Clin Pathol. 1996; 49: 102-106
        • Maass M.
        • Gieffers J.
        • Krause E.
        • Engel P.M.
        • Bartels C.
        • Solbach W.
        Poor correlation between microimmunofluorescence serology and polymerase chain reaction for detection of vascular Chlamydia pneumoniae infection in coronary artery disease patients.
        Med Microbiol Immunol. 1998; 187: 103-106
        • Ciufetti G.
        • Mannarino E.
        • Praticcia R.
        Leukocyte activity in chronic venous insufficiency.
        Int Angiol. 1994; 13: 312-316
        • Kuo C.C.
        • Shor A.
        • Campbell L.A.
        • Fukushi H.
        • Patton D.L.
        • Grayston J.T.
        Demonstration of Chlamydia pneumoniae in atherosclerotic lesions of coronary arteries.
        J Infect Dis. 1993; 167: 841-849
        • Grayston J.T.
        • Kuo C.C.
        • Coulson A.S.
        • Campbell L.A.
        • Lawrence R.D.
        • Lee M.J.
        • et al.
        Chlamydia pneumoniae (TWAR) in atherosclerosis of the carotid artery.
        Circulation. 1995; 92: 3397-3400
        • Chiu B.
        • Viira E.
        • Tucker W.
        • Fong I.W.
        Chlamydia pneumoniae, cytomegalovirus, and herpes simplex virus in Atherosclerosis of the carotid artery.
        Circulation. 1997; 96: 2144-2148
        • Juvonen J.
        • Juvonen T.
        • Laurila A.
        • Alakarppa H.
        • Lounatmaa K.
        • Surcel H.M.
        • et al.
        Demonstration of Chlamydia pneumoniae in the walls of abdominal aortic aneurysms.
        J Vasc Surg. 1997; 25: 499-505
        • Maass M.
        • Bartels C.
        • Engel P.M.
        • Mamat U.
        • Sievers H.H.
        Endovascular presence of viable Chlamydia pneumoniae is a common phenomenon in coronary artery disease.
        J Am Coll Cardiol. 1998; 31: 827-832
        • Farsak B.
        • Yildirir A.
        • Akyon Y.
        • Pinar A.
        • Oc M.
        • Boke E.
        • et al.
        Detection of Chlamydia pneumoniae and Helicobacter pylori DNA in human atherosclerotic plaques by PCR.
        J Clin Microbiol. 2000; 38: 4408-4411
        • Song Y.G.
        • Kwon H.M.
        • Kim J.M.
        • Hong B.K.
        • Kim D.S.
        • Huh A.J.
        • et al.
        Serologic and histopathologic study of Chlamydia pneumoniae infection in atherosclerosis.
        Yonsei Med J. 2000; 41: 319-327
        • Berger M.
        • Schroder B.
        • Daeschlein G.
        • Schneider W.
        • Busjahn A.
        • Buchwalow I.
        • et al.
        Chlamydia pneumoniae DNA in non-coronary atherosclerotic plaques and circulating leukocytes.
        J Lab Clin Med. 2000; 136: 194-200
        • Ouchi K.
        • Fujii B.
        • Kudo S.
        • Shirai M.
        • Yamashita K.
        • Gondo T.
        • et al.
        Chlamydia pneumoniae in atherosclerotic and nonatherosclerotic tissue.
        J Infect Dis. 2000; 181: 441-443
        • LaBiche R.
        • Koziol D.
        • Quinn T.C.
        • Gaydos C.
        • Azhar S.
        • Ketron G.
        • et al.
        Presence of Chlamydia pneumoniae in human symptomatic and asymptomatic carotid atherosclerotic plaque.
        Stroke. 2001; 32: 855-860
        • Virok D.
        • Kis Z.
        • Karai L.
        • Intzedy L.
        • Burian K.
        • Szabo A.
        • et al.
        Chlamydia pneumoniae in atherosclerotic middle cerebral artery.
        Stroke. 2001; 32: 1973-1976
        • Ong G.M.
        • Coyle P.V.
        • Barros D'Sa A.A.
        • McCluggage W.G.
        • Duprex W.P.
        • O'Neill H.J.
        • et al.
        Non-detection of Chlamydia species in carotid atheroma using generic primers by nested PCR in a population with a high prevalence of Chlamydia pneumoniae antibody.
        BMC Infect Dis. 2001; 1: 12
        • Rassu M.
        • Cazzavillan S.
        • Scagnelli M.
        • Peron A.
        • Bevilacqua P.A.
        • Facco M.
        • et al.
        Demonstration of Chlamydia pneumoniae in atherosclerotic arteries from various vascular regions.
        Atherosclerosis. 2001; 158: 73-79
        • Taylor-Robinson D.
        • Thomas B.J.
        • Goldin R.
        • Stanbridge R.
        Chlamydia pneumoniae in infrequently examined blood vessels.
        J Clin Pathol. 2002; 55: 218-220
        • Freidank H.M.
        • Lux A.
        • Dern P.
        • Meyer-Konig U.
        • Els T.
        Chlamydia pneumoniae DNA in peripheral venous blood samples from patients with carotid artery stenosis.
        Eur J Clin Microbiol Infect Dis. 2002; 21: 60-62
        • Shi Y.
        • Tokunaga O.
        Enigmatic relationship between Chlamydia pneumoniae and atherosclerosis.
        Pathol Int. 2003; 53: 736-748
        • Neureiter D.
        • Heuschmann P.
        • Stintzing S.
        • Kolominsky-Rabas P.
        • Barbera L.
        • Jung A.
        • et al.
        Detection of Chlamydia pneumoniae but not of Helicobacter pylori in symptomatic atherosclerotic carotids associated with enhanced serum antibodies, inflammation and apoptosis rate.
        Atherosclerosis. 2003; 168: 153-162
        • Lin T.M.
        • Chen W.J.
        • Chen H.Y.
        • Wang P.W.
        • Eng H.L.
        Increased incidence of cytomegalovirus but not Chlamydia pneumoniae in atherosclerotic lesions of arteries of lower extremities from patients with diabetes mellitus undergoing amputation.
        J Clin Pathol. 2003; 56: 429-432
        • Sessa R.
        • Di Pietro M.
        • Schiavoni G.
        • Santino I.
        • Benedetti-Valentini F.
        • Perna R.
        • et al.
        Chlamydia pneumoniae DNA in patients with symptomatic carotid atherosclerotic disease.
        J Vasc Surg. 2003; 37: 1027-1031