DNA-array of gene variants in venous leg ulcers: Detection of prognostic indicators
Article Outline
- Abstract
- Abstract
- Subjects and methods
- Results
- Discussion
- Author contributions
- Acknowledgment
- References
- Copyright
Objective
Wound healing in venous leg ulcer (VLU) is a multi-step process involving complex pathways. Scanty knowledge at molecular level hinders clinical assessment and treatment. Anomalous handling of local iron overload, as well as unbalancing in matrix metalloproteinases (MMPs) and transglutaminase, has a recognized role in VLU establishment. We selected a number of single nucleotide polymorphisms (SNPs) in candidate genes (HFE, FPN1, MMP12, and FXIII) involved in VLU to identify potentially prognostic markers by means of DNA-array technology.
Methods and Results
The DNA-array-genotyping was assessed in 638 subjects for the following SNPs: HFE (C282Y, H63D), FPN1 (−8CG), MMP12 (−82AG) and FXIII (V34L). Of the subjects, 221 were affected by VLU (171 primary and 50 post-thrombosis), 112 by severe chronic venous disease (CVD) (CEAP, C3-C4), while 305 were matched healthy controls. The HFE and FXIII SNPs had been previously genotyped by conventional polymerase chain reaction (PCR)-methods on the same group of subjects (J Vasc Surg 2005;42:309; J Vasc Surg 2006;44:554; J Vasc Surg 2006;44:815). For the purpose of DNA-array, they were re-genotyped by means of array-techniques resulting in a 100% matching. Intergroup statistical comparisons were performed. In the risk computation, the FPN1 −8GG genotype had an overall CVD risk of 4.3 (95% CI, 1.6-12) and a VLU risk of 5.2 (95% CI, 1.9-15) virtually the same among primary VLU (4.98; 95% CI, 1.82-14.9). The MMP12 −82AA genotype had a VLU risk of 1.96 (95% CI, 1.18-3.2) only in primary VLU (P = .01). In the genotype-ulcer size association studies, from a subgroup of 167 cases, we observed a smaller mean ulcer size in the MMP12 GG-genotype compared with the other genotypes (P = .001). Combining the present results with our previous published data on the same population, we suggest them to apply as tentative prognostic indicators in primary CVD.
Conclusion
By analyzing simultaneously selected SNPs, it might be possible to glean precious information in predicting VLU onset or in stratifying patients according to their potential to heal. Although significant, our findings must be considered preliminary and the proposed prognostic indicators considered with caution, before ulterior more extensive studies in different populations can eventually confirm the present findings.
Clinical Relevance
The DNA-array evaluation could be added to clinical CVD assessment. By analyzing simultaneously selected SNPs, it is possible to have precious information in predicting VLU onset or in stratifying patients according to their potential to heal. Prevention program in primary CVD could be improved by using DNA-array evaluation in initial patient assessment. Our results must be handled with extreme caution before considering them as prognostic indicators in VLU, and further larger studies in different populations are mandatory.
Among the major complications of chronic venous disease (CVD), venous leg ulcer (VLU) is one of the most severe. It accounts for a significant proportion of lower extremity wounds and is a widespread pathologic condition in developed countries.1, 2 Several conditions influence and exacerbate VLU such as diabetes mellitus, rheumatoid arthritis, trauma, sickle cell disease, vasculitis, and skin tumor. Both in Europe and in the United States, the prevalence of VLU is about 1%, with relative high costs for assistance and treatment. The cost is estimated at $1 billion per annum in the United States, while in the United Kingdom 14% of health costs are apportioned to wound care.3 Gender, age, ethnicity, and environment strongly influence penetrance of disease.2, 4, 5 Regardless of the clinical strategy used, evident variations in the outcome in patients with similar disease pattern and treatment are observed.6 Therefore, apart from CVD, increasing age and female gender, irrefutable evidence of predisposition to VLU is still limited and elusive. As regards to genetics, candidate genes could potentially be those involved in inflammatory processes, fibroblast growth factors, angiogenesis, or apoptosis. However, a recent paper comparing healing vs nonhealing lesion expression profiles found that none of the assumed genes involved in wound repair (ie, platelet-derived growth factors [PDGF] or keratinocyte growth factor [KGF]) were significantly downregulated in nonhealing ulcers.7 In recent years, hypothetical molecular mechanisms have been suggested, by means of which local iron overload facilitates the development of VLU. This model has been compared to other iron-driven lesions in neurodegenerative disorders.8, 9
Few data on single nucleotide polymorphisms (SNPs) and VLU are available in literature.10, 11, 12, 13 Our group recently acknowledged the patho-physiological role of iron deposition, iron trafficking genes, and transglutaminases in VLU establishment,14, 15, 16, 17, 18, 19, 20 recognizing a strong genetic component in ulcer pathogenesis.21, 22 In particular, the common HFE-C282Y and H63D SNPs play a role, respectively, in the risk of venous ulceration in primary CVD and in the modulation of the lesion onset.14, 15 The same gene variants also show significant effects in healing time after superficial venous surgery.17, 21 On the other hand, we found that additional SNPs could act as protective factors. Such is the case of the coagulation factor XIII gene (ie, FXIII V34L and P564L) acting on extracellular matrix (ECM) components and fibroblasts. Those variants show in vivo and in vitro positive effects on wound healing, tissue repairing, and remodelling.17, 18, 19, 20, 21
In the present paper, we investigated two additional SNPs in CVD patients, one in the promoter of the ferroportin gene (FPN1; −8CG), and another in the promoter of the matrix metalloproteinase 12 gene (MMP12; −82AG).
To date, no data are available concerning the role of FPN1 gene variants in CVD. The FPN1 −8CG polymorphism is extremely close to the iron responsive element (IRE) of the gene, thus potentially interfering with FPN1 expression.23, 24, 25, 26 The −82AG polymorphism in the MMP12 gene influencing promoter activity could plausibly play a role in leg ulcer progression as well as in other complex diseases by ECM degradation.27, 28, 29, 30, 31, 32
The new data obtained from the present investigation have been merged and computed together with previous data recently published by us on HFE and FXIII SNPs14, 17, 18, 20 to propose prognostic markers by means of a DNA-array approach in CVD.
Subjects and methods
We investigated a total of 638 subjects, classified as per the scheme in Fig 1.

Fig 1.
Whole cohort of subjects investigated. C3-C6 according to CEAP international classification of CVD. CVD, Chronic venous disease; VLU, venous leg ulcer.
Case group
Patients (n = 333), of whom 65% were females affected by CVD, had a mean age of 60.5 ± 14.5 years. Among these, 221 had C5-C6 VLU (171 primary and 50 post-thrombosis) and 112 had C3-C4 phenotype. All patients underwent clinical and duplex scanning examination. This investigation was conducted in conformity with consensus statement criteria and the methodology previously described.33, 34, 35 This approach enabled us to separate primary superficial from post-thrombotic cases and/or with deep venous reflux, as well as to identify patients with peripheral arterial disease.
Patient selection was put in place by means of strictly applied exclusion criteria17 (detailed below) in order to exclude any other comorbidity factor potentially involved in ulcer wound healing:
Subsequently, and prior to any treatment, the ulcerated area was assessed by means of software for calculating irregular areas (Visitrak Capture, Smith & Nephew UK Limited, London, UK). The age of ulcer onset in the groups with different genotypes was recorded. We did not utilize a specific cut-off to determine patients with early or late ulcer onset. The age was that recorded during the patients' initial consultation at the Vascular Disease Centre of the University-Hospital of Ferrara. In the event patients developed an ulcer before the end of data collection, their status was duly modified in our database and no other follow-up was made. Patients were recruited during the period from 2002 to 2005, as previously reported. Although significant, we could not account for occupational status or multiple pregnancies in women as confounders in this analysis.
Healthy controls
The control group consisted of 305 healthy subjects with no history of vascular disease and recruited from the blood donor file of Ferrara Hospital. They were matched by age, gender, and geographic origin with the CVD cases. All subjects enrolled in the study gave informed consent, and the survey was approved by the University-Hospital Ethics Committee of Ferrara.
DNA extraction and PCR conditions
The DNA was isolated from peripheral frozen whole blood by using the automated DNA extraction and purification robot (BioRobot EZ1 system, QIAGEN, Hilden, Germany), which performs the fully automated extraction and purification of nucleic acids using magnetic bead technology.
The PCR-protocol for the simultaneous amplification of the gene regions containing C282Y and H63D substitutions in the HFE gene, the −8CG substitution in the FPN1 gene promoter, the −82AG substitution in the MMP12 promoter, and the V34L substitution in the FXIII gene was carried out as follows: an initial 10 minutes at 94°C followed by 35 cycles of 95°C for 30 seconds, 56°C for 20 seconds, and 72°C for 90 seconds. The PCR cycles were performed in a Peltier Thermal Cycler apparatus (PTC-200; M J Research, Inc, Watertown, Mass) and were completed with a final extension step of 5 minutes at 72°C. The multiplex PCR-reaction was performed in 100 μl final volume containing 100 ng of genomic DNA, 20 μM dNTPs, 1.5 mM MgCl2, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 15 pmol of each primer, and 2.0 U of recombinant DNA polymerase (AmpliTaq Gold, Applied Biosystems, Branchburg, NJ).
Table IA, Table IB shows the sequences of the different pairs of primers needed for PCR and the oligos/probes utilized for genotyping according to the five polymorphisms in the study.
Table IA. Sequences of the different couples of PCR primers
| SNP | Sequence (5′-3′) | Amplicon size |
|---|---|---|
| FPN1 −8CG (Fw) Bio | CCAGTTCCTTGCACTCCTG | 129 bp |
| FPN1 −8CG (Rv) | CATCCTCTCTGGCGGTTG | |
| HFE C282Y (Fw) | CGAACCTAAAGACGTATTGCC | 183 bp |
| HFE C282Y (Rv) Bio | CCCAATAGATTTTCTCAGCTCCT | |
| HFE H63D (Fw) | GTTTGAAGCTTTGGGCTACG | 115 bp |
| HFE H63D (Rv) Bio | CCACATCTGGCTTGAAATTCT | |
| MMP12 −82AG (Fw) Bio | GCCTAAGTTCCTGAACTGTTCC | 129 bp |
| MMP12 −82AG (Rv) | AGTCATGCTTTTGTTTGCATGTT | |
| FXIII V34L (Fw) | GACCTTGTAAAGTCAAAAATGTC | 195 bp |
| FXIII V34L (Rv) Bio | ACCCAGAGTGGTGGGGAA |
Table IB. Oligonucleotides utilized in the reporter mix
| Oligo | Sequence |
|---|---|
| FPN1 −8CG Discriminator wild type | 5′-CTGAGTCCGAACATTGAG-AAAGGTCATGACACTAG-3′ |
| FPN1 −8CG Discriminator mutated | 5′-GCAGTATATCGCTTGACA-AAAGGTCATGACACTAC-3′ |
| FPN1 −8CG Stabilizer | 5′-GCGACCCCGCTGGCTCTTCTGCGGCTGCTA-3′ |
| HFE C282Y Discriminator wild type | 5′-CTGAGTCCGAACATTGAG-AGAGATATACGTG-3′ |
| HFE C282Y Discriminator mutated | 5′-GCAGTCTATCGCTTGACA-CAGAGATATACGTA-3′ |
| HFE C282Y Stabilizer | 5′-CCMGGTGGAGCACCCAGGCCT-3′ |
| HFE H63D Discriminator wild type | 5′-CTGAGTCCGAACATTGAG-TCGTGTTCTATGATC-3′ |
| HFE H63D Discriminator mutated | 5′-GCAGTATATCGCTTGACA-TCGTGTTCTATGATG-3′ |
| HFE H63D Stabilizer | 5′-ATGAGWGTCGCCGTGTGGAGCCCCGAA-3′ |
| MMP12 −82AG Discriminator wild type | 5′-CTGAGTCCGAACATTGAG-TTTGGGATGATATCAACTA-3′ |
| MMP12 −82AG Discriminator mutated | 5′-GCAGTATATCGCTTGACA-TTTGGATGATATCAACTG-3′ |
| MMP12 −82AG Stabilizer | 5′-TGAGTCACTCATAGGATTCATATTCACAGAACCCGG-3′ |
| FXIII-A V34L Discriminator wild type | 5′-CTGAGTCCGAACATTGAG-TTTGCTTCAGGGCG-3′ |
| FXIII-A V34L Discriminator mutated | 5′-GCAGTATATCGCTTGACA-TTTAGCTTCAGGGCT-3′ |
| FXIII-A V34L Stabilizer | 5′-TGGTGCCCCGGGGCGTCAC-3′ |
Genotyping on the Nanogen system
Amplicons were genotyped by the Nanogen microchip system (Nanochip Molecular Biology Workstation, Nanogen Corporate, San Diego, Calif). A volume of 10-20 μl containing the amplicon-mix was mixed with histidine buffer to 50 mmol/L final concentration in 60 μl final volume. About 100-200 ng of each amplicon were addressed onto the Nanochip Cartridge (H2-type) by means of the Nanochip Loader using default parameters. A chemical denaturation of amplicons, by means of NaOH 0.1N for 5 minutes of treatment, ended the addressing protocol. Each reporter mix contained probes (discriminator), stabilizers, and reporter oligonucleotides (details published on www.nanogen.com) specific for each SNP. Hybridization steps and fluorescence scans of the cartridge were carried out by the Nanochip Reader. An optimized hybridization touchdown protocol was determined for the analysis of each polymorphism. The instrumentation and general protocols followed are detailed in previous reports.36, 37 About 20% of samples were loaded and analyzed in duplicate, and heterozygous controls were always included in each assay. Quantitative analysis and genotype designation were realized by using specific software supplied by Nanogen and both were set at the diagnostic level.
Genotype confirming procedure
Haplotypes were confirmed by re-genotyping about 20% of random samples selected from each different genotype group per specific polymorphism by means of enzymatic restriction or direct sequence of the same amplicon utilized for the Nanochip procedure. There were no discrepancies between genotypes determined in duplicate and/or by different methods.
Statistical analysis
A retrospective cross-sectional study was performed. Statistical differences among groups were assessed by the t test and the χ2 test, respectively, for mean value and genotype distribution comparisons. Where appropriate, Yates' correction or Fisher's exact test were applied. Odds ratios (ORs) and 95% confidence intervals (95% CIs) were calculated by conditional logistic regression models, accounting variables and other confounding factors such as gender, age, and weight. In addition, the model accounts for a mutual adjustment of the different SNPs considered. The reported values were obtained by multiple comparison tests. Any P values ≤.05 were considered statistically significant. All analyses were performed using Systat V.5.0 (Systat Inc, Evanston, Ill) and SPSS Statistical Package (SPSS Inc, Chicago, Ill).
Results
Computing VLU risk
FPN1 −8CGTable II shows the computing of VLU risk assessed in the group of VLU cases (n = 221) compared to a subset of completely matched healthy controls (OR = 5.2; 95% CI, 1.9-15; P = .005). This was obtained by the comparison of the homozygous genotype in the FPN1 gene (GG) with the counterpart wild-type genotype (CC). Comparing the GG condition with the rest of the genotypes, the risk value remained stable and significance increased (OR = 4.4; CI 95%, 1.55-12.1; P = .002). In addition, the comparison between the subsets of C5-C6 patients (ie, primary vs post-thrombotic VLU) did not show significant associations to FPN1 genotypes, although an over-representation of the GG-homozygotes was present among primary VLU (9.35% vs 6.0%; P >.05). Considering the C5-C6 vs C3-C4 comparison, (ie, CVD patients with ulcer vs those without), it has obtained a significant over-representation of G-carriers among C5-C6 (43% vs 31.25%). This yielded an associated risk in developing the lesion of 1.7; (95% CI, 1.03-2.7; P = .045).
Table II. All VLU vs controls
| FPN1 −8CG | Cases (n = 221) | Controls (n = 221) |
|---|---|---|
| CC | 126 | 148 |
| CG | 76 | 68 |
| GG | 19 | 5 |
| P value | .005 | |
| OR (95% CI) | 5.2 | |
Table III shows the computing of VLU risk assessed in the subgroup of primary VLU cases (n = 171) compared to a subset of completely matched healthy controls (OR = 4.98; 95% CI, 1.82-14.9; P = .005). This was obtained from the comparison of the homozygous genotype in the FPN1 gene (GG) with the counterpart wild-type genotype (CC). Comparing the GG condition with the rest of the genotypes, risk value remained stable and significance increased (OR = 4.7; 95% CI, 1.6-14.1; P = .002).
Table III. Primary VLU vs controls
| FPN1 −8CG | Cases (n = 171) | Controls (n = 171) |
|---|---|---|
| CC | 96 | 115 |
| CG | 59 | 52 |
| GG | 16 | 4 |
| P value | .005 | |
| OR (95% CI) | 4.98 | |
In addition, the comparison of all CVD patients (n = 333) with the healthy controls (n = 305) yielded an increased risk of 4.3 (95% CI, 1.6-12; P = .002).
MMP12 −82AGConsidering the MMP12 polymorphism, a different genotype distribution was observed (P = .010) comparing primary VLU vs matched healthy controls (ie, cases: AA n = 139 [81.3%], AG n = 26 [15.2%], GG n = 6 [3.5%] vs controls: AA n = 118 [69%], AG n = 49 [28.7%], GG n = 4 [2.3%]). In addition (Table IV), considering only the homozygous AA-genotype, this was over-represented among primary VLUs with an associated risk of 1.96 (95% CI, 1.18-3.22; P = .010).
Table IV. Primary VLU vs controls
| MMP −82AG | Cases (n = 171) | Controls (n = 171) |
|---|---|---|
| AA | 139 | 118 |
| AG | 26 | 49 |
| GG | 6 | 4 |
| P value | .01 | |
| OR (95% CI) | 1.96 | |
Risk assessment in the groups of patients investigated fully resembled that of our previous reports.14, 17 In the present survey, C2282Y yielded a significant overall risk for CVD (OR = 4.5; 95% CI, 1.3-14.9; P = .001) and among primary CVD the risk further increased (OR = 6.5; 95% CI, 1.5-26.5; P = .001) (Table V). Conversely, the H63D gene variant did not show increased risk, but was responsible for an earlier ulcer onset among primary CVD (wild type vs 63D-carriers: 64 years ± 15 vs 55 years ± 14; P < .0001) in conformity with our previous reports.14, 15
Table V. Primary VLU vs CVD (C3C4)
| HFE C282Y | Cases (n = 171) | Controls (n = 112) |
|---|---|---|
| CC | 153 | 110 |
| CY | 17 | 2 |
| YY | 1 | 0 |
| P value | .001 | |
| OR (95% CI) | 6.5 | |
VLU size and different genotypes
FPN1 −8CGIn a subgroup of VLU patients (n = 167), the lesion size was available at the recruitment step. Considering the relationships between a specific FPN1 genotype and the relative mean ulcer size, it has obtained a nonsignificant trend (P = .30) towards increased size and the G-allele (CC, n = 101: 10 ± 19.26 cm2; CG, n = 56: 12.0 ± 25.6 cm2; GG, n = 10: 13.6 ± 14.2 cm2).
MMP12 −82AGIn the same subgroup of patients, we found a significant (P = .001) smaller mean size in the subgroup of patients carrying the MMP12 −82GG genotype (n = 6) when compared with the remaining genotypes (−82AA+AG; n = 161). The mean ulcer size in the patients with −82GG genotype was 5.4 ± 2.0 cm2 and in the remaining patients was 11.1 ± 17.1 cm2 (Fig 2).

Fig 2.
Relationships between MMP12 −82AG polymorphism and venous ulcer size. Mean and SD values are reported. The P value is obtained by t test.
The same subgroup yielded ulcer size stratification as shown in Fig 3: the size of the lesion was inversely related to the number of L34 allele in the genotype of patient (P trend = .001).

Fig 3.
Relationships between FXIII V34L polymorphism and venous ulcer size. Mean and SD values are reported. The P value is obtained by test for trend.
Previous data published on HFE and FXIII SNPs
As reported, the data on HFE and FXIII gene polymorphisms obtained in this study by the DNA-array procedure, fully matched previously published data obtained by conventional PCR techniques.14, 17, 18, 20 For this reason, only findings concerning FPN1 and MMP12 SNPs are reported in detail together with significant new findings for the remaining genes investigated. Nevertheless, the Method section of this article contains complete DNA-array procedures for all the SNPs computed. This is because the sequence of the oligonucleotides and the technical procedure utilized in the present study have never been published in literature before and the tentative investigative approach for VLU clinical assessment is based on the entire DNA-array evaluation.
Combined analysis
Of the 333 patients with CVD, 3% (n = 10) carried the HFE 282Y and the FPN1 −8G polymorphic allele in combination (ie, cases carrying at least two polymorphic alleles in the two different genes). Although extremely low, double carriers were exclusively distributed among the 221 VLU cases increasing the rate from 3% to 4.5%. The comparison of CVD cases with ulcer (C5-C6) vs those without (C3-C4), yielded a borderline significant over-representation of double carriers among ulcerated patients (P = .052).
Similarly, among the VLU patients in which the lesion size was available, those carrying in combination the MMP12 −82G and the FXIII 34L allele (n = 17), had a nonsignificant (P = .065) smaller mean ulcer size (9.0 cm2 ± 10) when compared to the 69 double wild-type cases (MMP12 −82AA/FXIII 34VV), (15.5 cm2 ± 17.5). Both findings, though borderline in statistical significance due to the low sample size, are in conformity with the protective role ascribed to the same alleles when considered in single analysis.
Investigative approach to VLU clinical assessment by DNA-array
Merging data obtained in the present survey (FPN1 −8CG and MMP12 −82AG) with those from additional SNPs (HFE C282Y, H63D, and FXIIIA V34L) reported in our previous investigations, we propose a provisional list of prognostic indicators in primary CVD (Table VI).
Table VI. Summary of the main findings in the present and previous studies
| SNPs | VLU risk (primary CVD) | Lesion onset (primary CVD) | Lesion size | Healing time (after CHIVA) | Ref. |
|---|---|---|---|---|---|
| HFE C282Y | Y-allele ↑ risk (6-7×) | — | — | No effect after correction | (14, 17, 21) |
| HFE H65D | — | D-allele ↓ age onset (∼10 y) | — | — | (15, 21) |
| FPN1 −8CG | GG-genotype↑ risk (∼5×) | — | GG-genotype ↑ size (NS) | — | This paper |
| MMP12 −82AG | AA-genotype↑ risk (∼2×) | — | GG-genotype ↓ size (∼2×) | — | This paper |
| FXIII V34L | — | — | L-allele ↓ size (∼3.5×) | VV-genotype ↑ HT (∼2×) | (20, 17, 21) |
| HFE/FPN1 | Y/G-carriers ↑ risk (NS) | — | — | — | This paper |
| FXIII/MMP12 | — | — | L/G-carriers ↓ size (NS) | — | This paper |
Discussion
Findings from the present study evidence that, by means of DNA-array evaluation, crucial information on VLU potentially useful for clinical management can be obtained. Recent studies on complementary DNA-microarray have demonstrated diversity in genetic expression of healing vs nonhealing wounds.7 An altered expression was found in genes that code for structural factors, mediators of inflammation and apoptotic pathways. The authors demonstrated that healing and nonhealing leg ulcers are characterized by a completely different genetic physiology. Similarly, our study aimed to identify a particular genetic background which, interacting with the environment, represents the multisided clinical phenotype characteristic of complex diseases such as CVD and VLU.
Equally effective is the genome wide association studies (GWAS) approach which identifies relevant patterns of numerous SNPs to predict future disease states and to evaluate gene patterns that relate to multiple phenotypes of complex diseases. Similarly, our aim, though limited, was to select SNPs of candidate genes potentially involved in the pathogenesis of VLU. This was done on the basis of accurate knowledge of the clinical and physiopathologic findings relative to the disease (see previous studies). Results from the present study, combined with previously investigated gene variants and selected clinical findings, proposes a molecular tool for identifying patients with potentially delayed healing or nonhealing ulcers. Although accounting just in part for the multipathway mechanisms, it could be valid in complex diseases and act as inducement for more extensive future investigations.
The gene markers identified by the DNA-array, are involved in susceptibility (HFE, FPN1; MMP12), healing time (FXIII), ulcer size (FXIII and MMP12), and response to surgery (FXIII). Although associated with appreciable statistical potential, additional genes and/or SNPs should be investigated in wider epidemiologic studies and confirmed in different populations to strengthen the potential of this molecular tool.
The selection of genes to investigate needs to be implemented on the basis of in-depth knowledge of the pathophysiologic grounds of the complex disease, and that of the gene variants on the basis of their associated phenotype, if known.
The fact that iron overload has a role in VLU, prompted us to investigate HFE and FPN1 gene variant. Although they were considered asymptomatic mutations for systemic diseases,38, 39, 40 we investigated them in combination with an acquired condition: CVD. In patients affected by severe CVD, the overlapping of local iron overload and the HFE mutations facilitates the occurrence of skin lesions and significantly anticipates the onset age of the ulcerative disease.14, 15 The HFE mutation modifies the stability of the ferritin deposits as well as the efficiency of the hepcidin regulation system, leading to increased iron efflux.41, 42, 43 We hypothesize that tissue lesion generates from enhanced iron release and consequent free radical production. Its role and mechanism in VLU has been widely described.15
Similarly, we decided to investigate the FPN1 gene (locus 2q32) and one of its polymorphisms in the promoter.40 The gene codes for a multiple transmembrane domain protein, and as opposed to other iron trafficking proteins, it is the only one identified exporting iron outside the cell.23, 24, 25 FPN1 SNPs have never been associated to any specific disease. Expressed by macrophage, the process is regulated at several different levels. FPN1 mRNA contains in the 5′-UTR region the IRE sequence which interacts with the iron regulatory proteins (IRP); it can also be regulated post-translationally by hepcidin. The existence of an IRE region in the 5′-UTR of FPN1 results in increased expression of the protein proportional to cellular iron loading, modulating iron export.26 The marked closeness of −8CG polymorphism to the crucial IRE region prompted us to investigate its role in VLU. Taking into account our hypothesis that tissue lesion generates from enhanced iron release, free radical production, and the pathophysiologic pathway described for HFE may also be applicable to FPN1 with the result that the two genes together can interact on VLU. The significant association we found between −8CG SNP and VLU susceptibility can speculatively be interpreted and summarized as follows: (1) A direct role of the polymorphism in the macrophage membrane as previously described for HFE C282Y.42, 43 Thus, the polymorphism could hamper the efflux of iron from inside the cell strongly contributing to increased oxidative stress and cell death; (2) An indirect role of still unknown molecular defects linked to −8CG SNP.
MMPs, together with their inhibitors tissue inhibitor of metalloproteinases (TIMPs), are involved in vascular remodeling and vascular disease.28 The regulation of MMP expression is complex and takes place at both transcriptional and post-transcriptional levels.44
MMP12 (locus 11q22.3), secreted by activated macrophages, digests several ECM components which enables macrophages to penetrate injured tissues.27, 28 MMP12 may block angiogenesis by converting plasminogen to angiostatin, a potent angiogenesis inhibitor. The −82AG polymorphism in the MMP12 promoter is very close to the transcriptional factor-binding site for AP1. For this reason, it may influence their specific interactions. The higher promoter activity of the A-allele described above compared to the G-allele gives expected higher expression levels. Although no basal difference was described between expressions of the two alleles, in transfecting experiments the response of A-allele is higher when cells are stimulated with insulin or phorbol myristate acetate.29 Small change in promoter activity was recorded between the two alleles and this could be sufficient and have significant effects on long-staying wounds. Accordingly, chronic higher expression of MMP12 in wounds of patients with −82A-allele may be responsible for the significant smaller ulcer size found in −82GG patients. The controversial fact that we did not find any risk association with the MMP12 A-allele (ie, cases with −82AG + −82AA genotypes), but only when the −82A-allele was in the homozygous condition, might indicate that the A-allele in single copy is not strong enough to be causative for ulcer onset. However, once the lesion appears it may modulate the size: AA and AG cases had a significant larger wound area. Finally, findings on the association of the polymorphism with coronary artery disease, cancer, and endometriosis have also been recently published.29, 30, 31, 32
FXIII strengthens the ECM components against unrestrained MMP proteolysis, favoring in turn fibroblast migration and proliferation and promoting neoangiogenesis and healing. The extent of these and additional actions strictly depends on the associated gene variants.19, 20, 21, 45 It could be hypothesized that a significant higher FXIII activity (ie, that of the L34-variant) at the wound site, could better promote wound healing by ameliorating the above-mentioned pathway resulting in reduced wound size and shortened wound healing time.17, 20
Apart from specific genotypes, the VLU area may also be influenced by past treatment practiced prior to our first clinical assessment. With regard to our data, the lesion size was recorded at the recruitment step before the start of any surgical or medical treatment. In addition, the cases in which the lesion area was recorded belonged to a group with restrictive inclusion criteria, as previously reported,17 this was in order to minimize several confounding factors masking the genotype effects.
In short, on the basis of the described results, prevention programs in primary CVD could be improved by using DNA-array evaluation in the initial patient assessment phase. Clinical practice could be potentially influenced by these results.22 One example is given by using HFE and FPN1 SNPs. A positive test for one or both gene variants would suggest indication and priority for surgical correction of superficial venous insufficiency while primary varicose veins could be treated more appropriately before any lesion appears in those patients with a critical gene haplotype.21, 22, 46
We conclude that by simultaneous analysis of selected SNPs, it might be possible to glean important information for predicting VLU onset stratifying patients according to their potential to heal.
It should be emphasized, however, that although significant, these findings have to be considered as preliminary. The proposed prognostic indicators should be used with caution and subjected to further trials on different populations prior to definitive confirmation.
Author contributions
We thank Dr Kathleen Galvin for the complete revision of the manuscript.
References
- . Chronic leg ulcers: the impact of venous disease. J Vasc Surg. 1999;29:752–755
- . Venous ulcer: epidemiology, physiopathology, diagnosis and treatment. Int J Dermatol. 2005;44:449–456
- . Validation of venous leg ulcer guidelines in the United States and United Kingdom. Am J Surg. 2002;183:132–137
- . A sociodemographic, clinical study of patients with venous ulcer. Int J Dermatol. 2005;44:989–992
- 'Real' epidemiology of varicose veins and chronic venous diseases: the San Valentino Vascular Screening Project. Angiology. 2002;53:119–130
- . Risk factors for delayed healing and recurrence of chronic venous leg ulcers—an analysis of 1324 legs. Eur J Vasc Endovasc Surg. 2005;29:74–77
- . A gene signature of nonhealing venous ulcers: potential diagnostic markers. J Am Acad Dermatol. 2008;59:758–771
- . The big idea: iron-dependent inflammation in venous disease and proposed parallels in multiple sclerosis. J R Soc Med. 2006;99:589–593
- . Hypothetical molecular mechanisms by which local iron overload facilitates the development of venous leg ulcers and multiple sclerosis lesions. Med Hypotheses. 2008;71:293–297
- The dinucleotide (CA) repeat polymorphism of estrogen receptor beta but not the dinucleotide (TA) repeat polymorphism of estrogen receptor alpha is associated with venous ulceration. J Steroid Biochem Mol Biol. 2005;97:266–270
- . Single nucleotide polymorphisms of the fibroblast growth factor receptor 2 gene in patients with chronic venous insufficiency with leg ulcer. J Invest Dermatol. 2005;124:1085–1088
- . Tumor necrosis factor-alpha gene polymorphism associated with increased susceptibility to venous leg ulceration. J Invest Dermatol. 2006;126:921–925
- Polymorphisms spanning the 0N exon and promoter of the estrogen receptor-beta (ERbeta) gene ESR2 are associated with venous ulceration. Clin Genet. 2008;73:55–61
- . Hemochromatosis C282Y gene mutation increases the risk of venous leg ulceration. J Vasc Surg. 2005;42:309–314
- The overlapping of local iron overload and HFE mutation in venous leg ulcer pathogenesis. Free Radic Biol Med. 2006;40:1869–1873
- Serum iron and matrix metalloproteinase-9 variations in limbs affected by chronic venous disease and venous leg ulcers. Dermatol Surg. 2005;31:644–649discussion 649
- Influence of gene polymorphisms in ulcer healing process after superficial venous surgery. J Vasc Surg. 2006;44:554–562
- Prognostic role of factor XIII gene variants in nonhealing venous leg ulcers. J Vasc Surg. 2006;44:815–819
- Factor XIII contrasts the effects of metalloproteinases in human dermal fibroblast cultured cells. Vasc Endovascular Surg. 2004;38:431–438
- Factor XIII V34L polymorphism modulates the risk of chronic venous leg ulcer progression and extension. Wound Repair Regen. 2004;12:512–517
- . Clinical implications of gene polymorphisms in venous leg ulcer: a model in tissue injury and reparative process. Thromb Haemost. 2007;98:131–137
- . Genetics of venous leg ulcer: an indication to priority of varicose veins treatment?. Int Angiol. 2008;27:91–92
- Positional cloning of zebrafish ferroportin1 identifies a conserved vertebrate iron exporter. Nature. 2000;403:776–781
- A novel duodenal iron-regulated transporter, IREG1, implicated in the basolateral transfer of iron to the circulation. Mol Cell. 2000;5:299–309
- . A novel mammalian iron-regulated protein involved in intracellular iron metabolism. J Biol Chem. 2000;275:19906–19912
- . Iron overload due to mutations in ferroportin. Haematologica. 2006;91:92–95
- . Cloning and characterization of a unique elastolytic metalloproteinase produced by human alveolar macrophages. J Biol Chem. 1993;268:23824–23829
- . Matrix metalloproteinases and their inhibitors in vascular remodeling and vascular disease. Biochem Pharmacol. 2008;75:346–359
- Allele-specific regulation of matrix metalloproteinase-12 gene activity is associated with coronary artery luminal dimensions in diabetic patients with manifest coronary artery disease. Circ Res. 2000;86:998–1003
- . Polymorphisms in the promoter regions of MMP-2, MMP-3, MMP-9 and MMP-12 genes as determinants of aneurysmal coronary artery disease. J Am Coll Cardiol. 2002;40:43–48
- Genetic polymorphisms of matrix metalloproteinase 12 and 13 genes are implicated in endometriosis progression. Hum Reprod. 2008;23:1207–1213
- Genotypes and haplotypes of matrix metalloproteinase 1, 3 and 12 genes and the risk of lung cancer. Carcinogenesis. 2006;27:1024–1029
- Minimally invasive surgical management of primary venous ulcers vs. compression treatment: a randomized clinical trial. Eur J Vasc Endovasc Surg. 2003;25:313–318
- . Investigation of chronic venous insufficiency: a consensus statement (France, March 5-9, 1997). Circulation. 2000;102:E126–E163
- Revision of the CEAP classification for chronic venous disorders: consensus statement. J Vasc Surg. 2004;40:1248–1252
- . Single-nucleotide polymorphism and mutation identification by the nanogen microelectronic chip technology. Methods Mol Med. 2005;114:93–106
- . Active microelectronic array system for DNA hybridization, genotyping and pharmacogenomic applications. Psychiatr Genet. 2002;12:181–192
- . Screening for hereditary haemochromatosis within families and beyond. Lancet. 2003;362:1897–1898
- . Penetrance of 845G—> A (C282Y) HFE hereditary haemochromatosis mutation in USA. Lancet. 2002;359:211–218
- . Seeking candidate mutations that affect iron homeostasis. Blood Cells Mol Dis. 2002;29:471–487
- Resistance hepcidin is conferred by hemochromatosis-associated mutations ferroportin. Blood. 2005;106:1092–1097
- The hemochromatosis protein HFE inhibits iron export from macrophages. Proc Natl Acad Sci U S A. 2002;99:15602–15607
- . Iron release from human monocytes after erythrophagocytosis vitro: an investigation in normal subjects and hereditary hemochromatosis patients. Blood. 1998;92:2511–2519
- . Regulation of gene expression by insulin: analysis in single living cells. Biochem Soc Trans. 1996;24:378–384
- Factor XIIIA-V34L and factor XIIIB-H95R gene variants: effects on survival in myocardial infarction patients. Mol Med. 2007;13:112–120
- The inflammatory chain in chronic venous leg ulcer. Acta Phlebol. 2006;7:39–44
This study was supported in part by funds from MIUR (the Italian Ministry for University Instruction and Research) and thanks to a grant from Fondazione Cassa di Risparmio - Cento, Italy.
Competition of interest: none.
The editors and reviewers of this article have no relevant financial relationships to disclose per the JVS policy that requires reviewers to decline review of any manuscript for which they may have a competition of interest.
PII: S0741-5214(09)01576-6
doi:10.1016/j.jvs.2009.07.103
© 2009 Society for Vascular Surgery. Published by Elsevier Inc. All rights reserved.
